Materials

Tris Base, Tris-HCl, Glucose, HEPES, nicotinamide guanine dinucleotide (NGD), cyclic guanosine diphosphoribose (cGDPR), 1,1,2,-trichlo-rotrifluoroethane, tri-n-octylamine, and other chemicals were purchased from Sigma Chemical Company (St. Louis, MO). Hanks balanced salt solution (HBSS), hexamers, oligo(dT), Taq DNA polymerase, and 100base pair (bp) DNA ladder were purchased from GibcoBRL (Grand Island, NY). Cellulose polyethyleneimine (PEI) thin-layer chromatography plates were purchased from Fisher Scientific (Pittsburgh, PA). Goat polyclonal anti-rat CD38 antibody, donkey anti-goat IgG, and horseradish peroxidase were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Gradient gels and Bio-Rad protein assay kit were purchased from Bio-Rad Laboratories (Hercules, CA). Estrogen detection kit was purchased from Diagnostic Products Corporation (Los Angeles, CA). Protease inhibitor cocktail set III (cat. no. 539134) was obtained from Calbiochem (La Jolla, CA). RNeasy mini kit was obtained from Qiagen (Valencia, CA). SYBR Green Master mix was purchased from Applied Biosystems (Foster City, CA). Resazurin, diaphorase, nicotinamide, nucleotide pyrophosphatase from Crotalus atrox venom, NADase from Neurospora crassa, and alkaline phosphatase from calf intestine were purchased from Boehringer, Roche Applied Science (Indianapolis, IN).

Experimental Animals and Design of Studies

Pregnant and nonpregnant female Sprague-Dawley rats were obtained from Harlan Laboratories (Madison, WI). Pregnant rats used in the investigations were at two different stages of pregnancy: preterm (14-17 days of gestation) and at parturition (term). Ovariectomized and thyroparathy-roidectomized rats (200-225 g) were also used in the studies. The ovari-ectomized rats were kept in the animal care facilities for 3 wk before the experiments and were given water supplemented with 0.25% calcium gluconate during this period. These rats were randomly divided into five groups: 1) controls, which were injected with sesame oil; 2) estrogen-treated group (E), which received estradiol-17p dissolved in sesame oil (200 |xg kg-1 day-1); 3) estrogen and 1 mg of progesterone (EP1) group, treated with estrogen and 1 mg of progesterone; 4) estrogen and 10 mg of progesterone (EP10) group, treated with estrogen and 10 mg of progesterone; and 5) estrogen and 20 mg of progesterone (EP20) group, treated with estrogen and 20 mg of progesterone. All the treatments were performed subcutaneously for 5 consecutive days. The doses of progesterone chosen in an attempt to vary the estrogen:progesterone ratios were based on studies described by others.

The animals were killed by intraperitoneal injection of sodium pentobarbital (50 mg/kg), followed by exsanguination. The myometrium was removed and kept in ice-cold HBSS, buffered with 10 mM HEPES (pH 7.4) and containing 2.5 mM CaCl2, 1.2 mM MgCl2, and 10 mM glucose. After removing pups, myometrium was cleaned from connective tissues and endometrium, a small piece of myometrium from each rat was removed, frozen immediately in liquid nitrogen, and stored at — 80°C. Due to the small size of the uterus for the control and progesterone-treated groups, myometrium from two rats was pooled for preparation of micro-somes and referred to as n value of 1. For the estrogen-treated groups and gestational animals, myometrium from individual animals was used for preparation of microsomes and n refers to the number of animals used in the study. All procedures with animals were done under the guidelines and with the approval of the University of Minnesota Institutional Animal Care and Use Committee.

Myometrial Smooth Muscle Membrane Preparation

Myometrial membrane was prepared as described previously. Briefly, myometrial tissues were minced and homogenized in 20 mM Tris-HCl, pH 7.2, containing 0.25 M sucrose and protease inhibitors (sucrose-Tris solution). The homogenate was centrifuged at 10 000 X g for 15 min and the resulting supernatant was centrifuged at 100 000 X g for 60 min. The individual pellets after 10 000 X g and 100 000 X g (microsomes) were suspended separately in sucrose-tris solution. Protein content of the microsomal fractions was determined using the Bio-Rad protein assay kit using bovine serum albumin as standard.

Detection of CD38 Protein in Uterine Microsomes

CD38 protein expression in the uterine microsomes was determined by Western blot as described in our previous study. Briefly, uterine microsomal proteins were electrophoresed on 4%-15% polyacrylamide gradient gels and the separated proteins transferred to a polyvinylidene difluoride membrane. The membranes were probed using a polyclonal goat anti-rat CD38 antibody. A horseradish peroxidase-conjugated donkey antigoat IgG was used as a secondary antibody. The blots were developed using Bio-Rad chemiluminescence detecting system. CD38 protein expression in samples from different groups was compared by densitometry.

Measurement of CD38 mRNA Expression in Rat Myometrium

CD38 mRNA expression in myometrium from different groups of rats was measured as described. Briefly, total RNA was extracted using RNeasy mini kit as per the manufacturer’s protocol. Reverse transcription of total RNA to first-strand cDNA was done using random hexamers and oligo (dT) primers. cDNA was amplified by polymerase chain reaction (PCR) using rat CD38-specific primers.

The PCR primers were designed using nucleotide sequence for rat CD38 (GenBank accession number D29646). The following primers were used in the study: sense: 5’TGCAACAAGATTCTTCTTTGGAGCA3′ (position between 400 and 425) and anti-sense: 5’CTCAGGATTTTT-CACACACTGAAG3′ (position between 876 and 900), giving a final 500-bp DNA product. Rat-actin primers producing an approximately 500-bp product were used as internal controls. The intensities of the bands were quantified by densitometry and the results expressed as the ratio of intensity of CD38 to that of p-actin in sample from the same rat.

Real-Time Quantitative PCR

Quantitative real-time PCR was done using SYBR Green PCR master mix. First-strand cDNA obtained by reverse transcription of total RNA was amplified by PCR using the ABI Prism 7700 sequence detection system and the fluorescence was collected three times during each cycle as described. The data were analyzed using Sequence Detection System version 1.7 software. All the samples were run in triplicate and the readings were normalized using No Template Control and Passive Reference dye included in the SYBR Green Master mix. p-Actin was used as an internal control in each run. Normalized fluorescence was plotted against cycle number (amplification plot) and the threshold suggested by the software was used to calculate Ct (cycle at threshold). Results of the real-time PCR were expressed as Ct and the level of expression of CD38 was indicated by the number of cycles required to achieve the threshold level of amplification.

Detection of cADPR Levels in Uterine Smooth Muscle

Levels of cADPR in rat uterine smooth muscle were detected using a method described previously. Briefly, uterine tissues were cleaned from connective tissues and endometrium and then frozen in liquid N2. Frozen samples were homogenized in 0.5 M ice-cold perchloric acid (PCA). After removal of protein by centrifugation at 7000 X g for 7 min, PCA was removed by mixing the PCA supernatant with a mixture of 1,1,2,-trichlorotrifluoroethane and tri-n-octylamine (3:1 volume). Following vigorous mixing for 30 sec and centrifugation of the samples at 7000 X g for 5 min, the upper aqueous layer was recovered and adjusted to pH 7.5 by adding Tris-base (2-5 |xl of 2 M). Subsequently, samples were treated with enzymes to remove pyridine nucleotides, and cADPR levels were assayed as described previously.

Measurement of ADP-Ribosyl Cyclase Activity in Uterine Microsomes

ADP-ribosyl cyclase activity in the myometrial microsomes was determined by measuring the conversion of NGD, an analog of nicotinamide adenine dinucleotide, to cGDPR using a spectrofluorometer (Shimadzu Corporation, Kyoto, Japan), as described before. The specific ADP-ribosyl cyclase activity was calculated using cGDPR standards, and the results were represented as nanomoles cGDPR per milligram protein per minute.

Ca2+ Release Bioassay for ADP-Ribosyl Cyclase Activity in Uterine Microsomes

ADP-ribosyl cyclase activity in uterine smooth muscle microsomes was also assayed by determining the amount of 3-deaza-NAD converted to 3-deaza-cADPR. Microsomes (50 |xg protein) were incubated with 100 |xM 3-deaza-NAD in buffer at pH 7.2 at 37°C in a total volume of 100 |j,l. At various times, 5 |xl was removed and quickly added to 5 |xl of 100 mM HCl to stop the reaction. Samples were kept frozen until assayed. The amount of 3-deaza-cADPR formed was determined using a sea urchin egg homogenate calcium release bioassay. The 3-deaza-NAD was chosen as the substrate as the 3-deaza-cADPR product is 70 times more potent than cADPR in the calcium release bioassay and it is metabolically stable to enzymatic degradation. Aliquots of the stopped reactions (1.5 |xl) were added to wells of a 96-well plate, and calcium release was initiated by adding 150 |xl of sea urchin egg homogenate to each well. The preparation of the egg homogenate has been previously described. Calcium release was measured using a BMG FluoStar 96-well fluorescence plate reader. The amount of 3-deaza-cADPR formed during incubations with uterine smooth muscle microsomes was determined by comparing the amount of calcium released with a standard curve generated with 3-deaza-cADPR standards.

Measurement of cADPR Hydrolase Activity in Uterine Microsomes

The cADPR hydrolase activity was measured in the uterine microsomal fraction using 32P-cADPR as substrate, as described earlier. Briefly, microsomal protein was incubated at 37°C in 20 mM Tris-HCl buffer, pH 7.2, containing 32P-cADPR and 600 |xM unlabeled cADPR. At different time points, 1 |xl of the reaction mixture was spotted on a PEI cellulose plate. The plate was developed in a solution containing 30% ethanol and 0.2 M NaCl, dried, and exposed to a phosphorimage screen. The amount of cADPR hydrolyzed to ADPR in the reaction was calculated by quantifying the densities of the spots corresponding to cADPR and ADPR using the Optiquant Imaging System. The cADPR hydrolase enzyme activity was expressed as nanomoles ADPR (milligram protein)-1 (minute)-1.

Statistical Analysis

All the data were analyzed by Student f-test or one-way ANOVA with Bonferroni multiple comparison test using the Graph Pad Prizm program. The significance was set at P < 0.05 and values are presented as mean ± SEM. For analysis, n values were used and refer to number of determinations.